DNA,d(G-G-T-G-G-C-G-A-C-G-A-C-T-C-C-T-G-G-A-G-C-C-C-G) (9CI) - CAS 139528-83-9
Catalog number: 139528-83-9
Category: Main Product
Molecular Formula:
C232H292 N95 O142 P23
Molecular Weight:
0
COA:
Inquire
Purity:
95%
Synonyms:
GGTGGCGACGACTCCTGGAGCCCG; D(GGTGGCGACGACTCCTGGAGCCCG); LAMBDA GT11 (FORWARD); LAMBDA GT11 PRIMER, FORWARD, 24-MER; 5μ-GGT GGC GAC GAC TCC TGG AGC CCG-3μ
MSDS:
Inquire
Molecular Weight Calculator Molarity Calculator Solution Dilution Calculator

Related Products


Quick Inquiry

Verification code

Featured Items